Your genome stays in your browser. VCF parsing, variant matching, and genome chat all run client-side. Only variant summaries (gene + position) go to BioLLM when you chat.
Upload + Chat + Quick Designer — 100% client-side. Your VCF is parsed in JavaScript and never leaves your browser. When you chat with BioLLM, only a summary of variant positions (not your full genome) is sent for AI analysis.
CRISPR Guide Design (step 4) — If you choose to design guides, your VCF is sent to the server for the OpenCure pipeline (NCBI reference lookup, guide scoring, off-target analysis). It is deleted immediately after processing and all data is purged within 1 hour. You can delete manually at any time. This step is clearly marked and fully opt-in.
No cookies, no tracking, no analytics on genomic data. Data is never sold or shared with third parties. All communication uses HTTPS. Source code is visible in page source.
Acknowledgment Required Before Use
OpenCure is an experimental research platform powered by the OpenCure pipeline and BioLLM. It creates personalized CRISPR guide RNA designs based on your uploaded genomic data and published scientific literature. It is provided for educational and research purposes only.
Please read and acknowledge each statement below. All boxes must be checked to proceed.
0 of 7 acknowledged
1 Upload Your Genome
Drop a VCF file here or click to browse 100% client-side — your genome never leaves this browser
Only variant summaries (gene, position, type) are sent to BioLLM — never your full VCF. All parsing happens in your browser.
4 Design CRISPR Guides
Ready to design therapeutic guide RNAs for your variants? Select the diagnosis category that best matches your condition and the OpenCure pipeline will design patient-specific CRISPR guides.
This step sends your VCF to the server for processing. Your file is deleted immediately after the pipeline completes and all data is purged within 1 hour.
5 Your CRISPR Guides
Gene
Guide Sequence (5'→3')
PAM
Score
Strand
GC%
Spans Variant
Order from Synthego
Your guides are designed. Here's how to get them synthesized:
Click "copy for Synthego" above — this copies your top guide sequences (without PAM) to your clipboard, one per line, ready to paste.
Select SpCas9 as your nuclease. The guides above are 20nt designed for NGG PAM.
Paste your sequences into the order form — one guide per line. Synthego's system will validate them automatically.
Choose your scale: 1.5 nmol ($84) for initial screening of multiple guides, 10 nmol ($199) for cell line experiments, or 100 nmol ($1,040) for in vivo work.
Select "Modified" for 2'-O-methyl + phosphorothioate chemical modifications — these increase stability and editing efficiency by 2-3x vs unmodified.
Complete checkout. Synthego ships in 1-2 business days with nuclease-free TE buffer included.
Validate your top 3-5 guides by T7 endonuclease I assay or amplicon NGS. Prioritize guides that span your patient-specific variants (marked in the table above). All therapeutic use requires IRB/IBC approval.
1 Input Sequence
Drop a FASTA file here or click to browse
2 Configure
Nuclease
Guide Length
Min GC%
Max GC%
3 Guide Results
#
Score
Guide Sequence (5'→3')
GC%
Position
Strand
PAM
Order Synthetic Guide RNAs
Once you've identified your top-scoring guides, you can order them as synthetic sgRNAs from Synthego for wet-lab validation:
Export your guides using the CSV or FASTA button above. Note the 20nt guide sequences (without the PAM).
Paste your guide sequences without the PAM. For SpCas9, enter the 20nt sequence only — do not include the NGG. For example, if your guide + PAM is ATCGATCGATCGATCGATCGAGG, enter only ATCGATCGATCGATCGATCG.
Select your yield — 1.5 nmol ($84) is sufficient for initial screening; scale up to 10+ nmol for larger experiments.
Choose chemical modifications — the "enhanced" option with 2'-O-methyl and phosphorothioate modifications improves stability and is recommended for most applications.
Review and order. Synthego ships synthetic sgRNAs in 1-2 business days with included nuclease-free resuspension buffer.
We recommend ordering your top 3-5 scoring guides and validating editing efficiency via T7 endonuclease assay or NGS before proceeding to functional experiments.